Affordable Access

deepdyve-link
Publisher Website

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Authors
  • Leal, Ricardo M F
  • Callow, Shirley
  • Callow, Phil
  • Blakeley, Matthew P
  • Cardin, Christine J
  • Denny, William A
  • Teixeira, Susana C M
  • Mitchell, Edward P
  • Forsyth, V Trevor
Type
Published Article
Journal
Acta Crystallographica Section D Biological Crystallography
Publisher
International Union of Crystallography
Publication Date
Nov 01, 2010
Volume
66
Issue
Pt 11
Pages
1244–1248
Identifiers
DOI: 10.1107/S0907444910017713
PMID: 21041945
Source
Medline
License
Unknown

Abstract

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Report this publication

Statistics

Seen <100 times