While antibiotics are intended to specifically target bacteria, most are known to affect host cell physiology. In addition, some antibiotic classes are reported as immunosuppressive for reasons that remain unclear. Here, we show that Linezolid, a ribosomal-targeting antibiotic (RAbo), effectively blocked the course of a T cell-mediated autoimmune d...
The formation of bacterial biofilms has increased the resistance of bacteria to various environmental factors and is tightly associated with many persistent and chronic bacterial infections. Herein we design a strategy conjugating florfenicol, an antibiotic commonly used in the treatment of streptococcus, with the antimicrobial biomaterial, chitosa...
The formation of bacterial biofilms has increased the resistance of bacteria to various environmental factors and is tightly associated with many persistent and chronic bacterial infections. Herein we design a strategy conjugating florfenicol, an antibiotic commonly used in the treatment of streptococcus, with the antimicrobial biomaterial, chitosa...
Background The treatment of enteric fever is complicated by the emergence of antimicrobial resistant Salmonella Typhi. Azithromycin is commonly used for first-line treatment of uncomplicated enteric fever, but the response to treatment may be sub-optimal in some patient groups when compared with fluoroquinolones. Methods We performed an analysis of...
Background: Bacterial ophthalmic infections are common. Empirical treatment with topical broad-spectrum antibiotics is recommended for severe cases. Antimicrobial resistance (AMR) to agents used for bacterial ophthalmic infections make it increasingly important to consider changing resistance patterns when prescribing, however UK data in this area ...
Zebrafish-based platforms have recently emerged as a useful tool for toxicity testing as they combine the advantages of in vitro and in vivo methodologies. Nevertheless, the capacity to metabolically convert xenobiotics by zebrafish eleuthero embryos is supposedly low. To circumvent this concern, a comprehensive methodology was developed wherein te...
Song, KMCho, MJo, HMin, KJeon, SHKim, THan, MSKu, JKBan, C
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation con...