Background: Bacterial ophthalmic infections are common. Empirical treatment with topical broad-spectrum antibiotics is recommended for severe cases. Antimicrobial resistance (AMR) to agents used for bacterial ophthalmic infections make it increasingly important to consider changing resistance patterns when prescribing, however UK data in this area ...
Zebrafish-based platforms have recently emerged as a useful tool for toxicity testing as they combine the advantages of in vitro and in vivo methodologies. Nevertheless, the capacity to metabolically convert xenobiotics by zebrafish eleuthero embryos is supposedly low. To circumvent this concern, a comprehensive methodology was developed wherein te...
X / 1 / 69 / 64
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation con...
Sanofi-Aventis
Sanofi-Aventis
Sanofi-Aventis
A total of 50 Staphylococcus intermedius strains isolated in France from canine pyodermas in 2002 were investigated for their susceptibility to various antimicrobial drugs. Antimicrobial susceptibility was assessed using a 2-fold serial dilution method in Mueller-Hinton agar, and the minimal inhibitory concentrations (MICs) were determined. About 6...
The objective of this clinical trial was to examine the effect of a single dose of florfenicol on antimicrobial resistance patterns in faecal E. coli of feedlot steers. Steers (n = 370), were purchased from two sources and housed in outdoor concrete floored pens. Two cattle from each pen (n = 42 pens, 84 cattle) were randomly selected for faecal sa...
Includes bibliographical references / Available from British Library Document Supply Centre- DSC:7661. 9029(no. 0247) / BLDSC - British Library Document Supply Centre / SIGLE / GB / United Kingdom
